pET28a-TS2126 RnlA-Strep
(Plasmid #159350)

• Purpose: Express TS2126 RNA ligase with His6 tag and Strep tag at N and C terminal, respectively
• Depositing Lab: Takashi Ito
• Publication: Hisano et al BMC Biol. 2021 Oct 14;19(1):225. doi: 10.1186/s12915-021-01160-8.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: Merck
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 6512
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Growth instructions: Use T7Express cells in L broth for protein expression.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TS2126 RNA ligase
• Species: Synthetic; Thermus scotoductus bacteriophage TS2126
• Insert Size (bp): 1320
• GenBank ID: CQ796353
• Promoter: T7
• Tags / Fusion Proteins:
  • His6 (N terminal on backbone)
  • Strep (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGATCCCGCGAAATTAATACGACT
• 3′ sequencing primer: GTTTAGAGGCCCCAAGGGGTTATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry