Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-TS2126 RnlA-Strep
(Plasmid #159350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159350 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Merck
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 6512
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use T7Express cells in L broth for protein expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TS2126 RNA ligase
  • Species
    Synthetic; Thermus scotoductus bacteriophage TS2126
  • Insert Size (bp)
    1320
  • GenBank ID
    CQ796353
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 (N terminal on backbone)
    • Strep (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGATCCCGCGAAATTAATACGACT
  • 3′ sequencing primer GTTTAGAGGCCCCAAGGGGTTATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-TS2126 RnlA-Strep was a gift from Takashi Ito (Addgene plasmid # 159350 ; http://n2t.net/addgene:159350 ; RRID:Addgene_159350)
  • For your References section:

    Short single-stranded DNAs with putative non-canonical structures comprise a new class of plasma cell-free DNA. Hisano O, Ito T, Miura F. BMC Biol. 2021 Oct 14;19(1):225. doi: 10.1186/s12915-021-01160-8. 10.1186/s12915-021-01160-8 PubMed 34649537