INS-2A-luciferase-2A-tdT
(Plasmid
#159348)
-
PurposeHuman INS targeting vector for knockin of 2A separated luciferase and tdTomato. Targeted cells will be puromycin resistant.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePL253
-
Vector typeINS locus knockin donor vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable ; Stbl 3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase-2A-tdTomato
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggagaactactgcaacggtacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
INS-2A-luciferase-2A-tdT was a gift from Rudolf Jaenisch (Addgene plasmid # 159348 ; http://n2t.net/addgene:159348 ; RRID:Addgene_159348) -
For your References section:
Human T Cells Expressing a CD19 CAR-T Receptor Provide Insights into Mechanisms of Human CD19-Positive beta Cell Destruction. Ma H, Jeppesen JF, Jaenisch R. Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22. 10.1016/j.xcrm.2020.100097 PubMed 33205073