pCMV-AAVS1-TALEN-L
(Plasmid
#159299)
-
PurposeTALEN (left) targeting the AAVS1 locus with obligate heterodimer FokI
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA
- Backbone size w/o insert (bp) 4506
- Total vector size (bp) 7518
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN targeting the AAVS1
-
SpeciesSynthetic
- Promoter CMV promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgggagtttgttttggcacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-AAVS1-TALEN-L was a gift from Kosuke Yusa (Addgene plasmid # 159299 ; http://n2t.net/addgene:159299 ; RRID:Addgene_159299)