pZFN-AAVS1_ELD
(Plasmid
#159297)
-
PurposeZFN (left) targeting the AAVS1 locus with obligate heterodimer FokI
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159297 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMV vector
- Backbone size w/o insert (bp) 2967
- Total vector size (bp) 4032
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFN targeting the AAVS1 locus
-
SpeciesSynthetic
-
Insert Size (bp)1065
- Promoter CMV promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gttttggcaccaaaatcaac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZFN-AAVS1_ELD was a gift from Kosuke Yusa (Addgene plasmid # 159297 ; http://n2t.net/addgene:159297 ; RRID:Addgene_159297)
