pKLV-EF1aGFP2AKAT7-linker-mAID-W
(Plasmid #159294)

• Purpose: Lentiviral vector expressing GFP and KAT7 (gRNA-resistant, mAID-tagged) driven by human EF1a promoter
• Depositing Lab: Kosuke Yusa
• Publication: Au et al Leukemia. 2021 Apr;35(4):1012-1022. doi: 10.1038/s41375-020-1001-z. Epub 2020 Aug 6.

Backbone

• Vector backbone: pKLV-EF1aGFP
• Backbone size w/o insert (bp): 8825
• Total vector size (bp): 10883
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KAT7
• Species: H. sapiens (human)
• Insert Size (bp): 2058
• Mutation: CRISPR sites mutated (gRNA ID. 5 and A10)
• Entrez Gene: KAT7 (a.k.a. HBO1, HBOA, MYST2, ZC2HC7)
• Promoter: human EF1a promoter
• Tag / Fusion Protein:
  • mAID (auxin-inducible degron)-tagged

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGCTGCCCGACAACCACTACCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.04.25.054049v1 for bioRxiv preprint.