pKLV-EF1aGFP2AKAT7-W
(Plasmid
#159292)
-
PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant) driven by human EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKLV-EF1aGFP
- Backbone size w/o insert (bp) 8825
- Total vector size (bp) 10661
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKAT7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1836
-
MutationCRISPR sites mutated (gRNA ID. 5 and A10)
-
Entrez GeneKAT7 (a.k.a. HBO1, HBOA, MYST2, ZC2HC7)
- Promoter human EF1a promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCTGCCCGACAACCACTACCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.04.25.054049v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV-EF1aGFP2AKAT7-W was a gift from Kosuke Yusa (Addgene plasmid # 159292 ; http://n2t.net/addgene:159292 ; RRID:Addgene_159292) -
For your References section:
KAT7 is a genetic vulnerability of acute myeloid leukemias driven by MLL rearrangements. Au YZ, Gu M, De Braekeleer E, Gozdecka M, Aspris D, Tarumoto Y, Cooper J, Yu J, Ong SH, Chen X, Tzelepis K, Huntly BJP, Vassiliou G, Yusa K. Leukemia. 2021 Apr;35(4):1012-1022. doi: 10.1038/s41375-020-1001-z. Epub 2020 Aug 6. 10.1038/s41375-020-1001-z PubMed 32764680