Skip to main content
Addgene

pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W
(Plasmid #159289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159289 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuroBFP-W
  • Backbone size w/o insert (bp) 8630
  • Total vector size (bp) 8650
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guide RNA targeting KAT6A (ID. A7)
  • gRNA/shRNA sequence
    GCGGCGGATAATCACAAATC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_006766
  • Entrez Gene
    KAT6A (a.k.a. ARTHS, MOZ, MRD32, MYST-3, MYST3, RUNXBP2, ZC2HC6A, ZNF220)
  • Promoter human U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W was a gift from Kosuke Yusa (Addgene plasmid # 159289 ; http://n2t.net/addgene:159289 ; RRID:Addgene_159289)
  • For your References section:

    KAT7 is a genetic vulnerability of acute myeloid leukemias driven by MLL rearrangements. Au YZ, Gu M, De Braekeleer E, Gozdecka M, Aspris D, Tarumoto Y, Cooper J, Yu J, Ong SH, Chen X, Tzelepis K, Huntly BJP, Vassiliou G, Yusa K. Leukemia. 2021 Apr;35(4):1012-1022. doi: 10.1038/s41375-020-1001-z. Epub 2020 Aug 6. 10.1038/s41375-020-1001-z PubMed 32764680