Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1-PDL1
(Plasmid #159280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159280 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC57
  • Vector type
    Mammalian Expression, AAV ; S1 knockin donor vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human PDL1/CD274
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    873
  • Entrez Gene
    CD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)
  • Promoter CAGGS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer ggcggctctagagcctctgctaacc
  • 3′ sequencing primer ttggcagagggaaaaagatctcagtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-PDL1 was a gift from Rudolf Jaenisch (Addgene plasmid # 159280 ; http://n2t.net/addgene:159280 ; RRID:Addgene_159280)
  • For your References section:

    Human T Cells Expressing a CD19 CAR-T Receptor Provide Insights into Mechanisms of Human CD19-Positive beta Cell Destruction. Ma H, Jeppesen JF, Jaenisch R. Cell Rep Med. 2020 Sep 22;1(6):100097. doi: 10.1016/j.xcrm.2020.100097. eCollection 2020 Sep 22. 10.1016/j.xcrm.2020.100097 PubMed 33205073