pET11a-DAAT-V33G/T242G
(Plasmid #159278)

• Purpose: Aminotransferase variant with near-native catalytic efficiency toward D-tryptophan
• Depositing Lab: Roberto Chica
• Publication: Parmeggiani et al ACS Catalysis 9, 3482–3486.

Backbone

• Vector backbone: pET-11a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5677
• Total vector size (bp): 6517
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Engineered d-alanine aminotransferase
• Alt name: DAAT-V33G/T242G
• Species: Bacillus sp.
• Insert Size (bp): 876
• Mutation: Valine 33 and threonine 242 have been mutated to glycine
• GenBank ID: J04460.1
• Promoter: T7
• Tag / Fusion Protein:
  • 6x His tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: T7 TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 Terminal GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET11a DAAT V33GT242G.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry