Skip to main content
Addgene

pAAV-pMecp2-SaCas9-pU6-sgRNA
(Plasmid #159173)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159173 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX601 (Addgene #61591)
  • Total vector size (bp) 6889
  • Modifications to backbone
    replaced CMV promoter with pMecp2; replace bGHpA with spA
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SaCas9
  • Species
    Synthetic
  • Insert Size (bp)
    3260
  • Promoter pMecp2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BamH (unknown if destroyed)
  • 5′ sequencing primer GCAGGTTGTAGTCGAACAGCAGCT
  • 3′ sequencing primer CAGCACAGACATTCTGGGCAACCT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pMecp2-SaCas9-pU6-sgRNA was a gift from Chung Tin (Addgene plasmid # 159173 ; http://n2t.net/addgene:159173 ; RRID:Addgene_159173)

  • For your References section:

    Targeted Transgene Activation in the Brain Tissue by Systemic Delivery of Engineered AAV1 Expressing CRISPRa. Lau CH, Ho JW, Lo PK, Tin C. Mol Ther Nucleic Acids. 2019 Jun 7;16:637-649. doi: 10.1016/j.omtn.2019.04.015. Epub 2019 Apr 23. 10.1016/j.omtn.2019.04.015 PubMed 31108320
Related items:
Commonly requested with: