pET-28a RUVBL2 Full Length
(Plasmid
#159142)
-
PurposeExpresssion and protein purification of full length RUVBL2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRUVBL2
-
SpeciesH. sapiens (human)
-
Entrez GeneRUVBL2 (a.k.a. CGI-46, ECP-51, ECP51, INO80J, REPTIN, RVB2, TAP54-beta, TIH2, TIP48, TIP49B)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequencing was performed with T7, T7 terminal and R2 (GCTGGAGATGATCCGGGAAGGGA) primers.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a RUVBL2 Full Length was a gift from Eric Erquan Zhang (Addgene plasmid # 159142 ; http://n2t.net/addgene:159142 ; RRID:Addgene_159142) -
For your References section:
Chemical perturbations reveal that RUVBL2 regulates the circadian phase in mammals. Ju D, Zhang W, Yan J, Zhao H, Li W, Wang J, Liao M, Xu Z, Wang Z, Zhou G, Mei L, Hou N, Ying S, Cai T, Chen S, Xie X, Lai L, Tang C, Park N, Takahashi JS, Huang N, Qi X, Zhang EE. Sci Transl Med. 2020 May 6;12(542). pii: 12/542/eaba0769. doi: 10.1126/scitranslmed.aba0769. 10.1126/scitranslmed.aba0769 PubMed 32376767