Skip to main content
Addgene

pET-28a RUVBL2 Full Length
(Plasmid #159142)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159142 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET-28a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RUVBL2
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUVBL2 (a.k.a. CGI-46, ECP-51, ECP51, INO80J, REPTIN, RVB2, TAP54-beta, TIH2, TIP48, TIP49B)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing was performed with T7, T7 terminal and R2 (GCTGGAGATGATCCGGGAAGGGA) primers.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a RUVBL2 Full Length was a gift from Eric Erquan Zhang (Addgene plasmid # 159142 ; http://n2t.net/addgene:159142 ; RRID:Addgene_159142)

  • For your References section:

    Chemical perturbations reveal that RUVBL2 regulates the circadian phase in mammals. Ju D, Zhang W, Yan J, Zhao H, Li W, Wang J, Liao M, Xu Z, Wang Z, Zhou G, Mei L, Hou N, Ying S, Cai T, Chen S, Xie X, Lai L, Tang C, Park N, Takahashi JS, Huang N, Qi X, Zhang EE. Sci Transl Med. 2020 May 6;12(542). pii: 12/542/eaba0769. doi: 10.1126/scitranslmed.aba0769. 10.1126/scitranslmed.aba0769 PubMed 32376767
Related items:
Commonly requested with: