Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEXPqcxip-hCCDC47-FLAG
(Plasmid #159141)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159141 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    modified pQCXIP
  • Backbone manufacturer
    Clontech / Takara Bio
  • Backbone size w/o insert (bp) 7278
  • Total vector size (bp) 8736
  • Modifications to backbone
    Clontech's pQCXIP (7165 bp) vector was modified by insertion of a cassette into the BamHI site to create a Gateway Destination vector with a c-terminal FLAG tag. CCDC47 was inserted by a Gateway reaction, leaving 25bp recombination ATTB sequences on either side of CCDC47 sequence, followed by one FLAG epitope.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    coiled-coil domain containing 47
  • Alt name
    CCDC47; THNS; GK001; MSTP041
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1458
  • GenBank ID
    BC008905 NM_020198.3
  • Entrez Gene
    CCDC47 (a.k.a. GK001, MSTP041, THNS)
  • Promoter CMV (cytomegalovirus) enhancer and the MSV (mouse sarcoma virus) promoter
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer acgccatccacgctgttttgacct
  • 3′ sequencing primer gcggaattccggatcG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    'PlasmID Repository' of the Dana Farber /Harvard Cancer Center DNA Resource Core, now closed.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Bicistronic expression of CCDC47 and puromycin resistance.

Using the given reverse primer, the FLAG tag cannot be Sanger sequenced since they are only 17bp apart. More distant primers give poor sequence data because of the homomeric sequence of the IRES 3' of the insert.
This is the more distal reverse sequencing primer originally suggested by Clontech, which gives poor data: aagcggcttcggccagtaacgtta .

Alternate 5' CMV primers can be used, but they should first be checked against the vector's sequence to make sure that they do not occur more than one time.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEXPqcxip-hCCDC47-FLAG was a gift from Martin Dorf (Addgene plasmid # 159141 ; http://n2t.net/addgene:159141 ; RRID:Addgene_159141)
  • For your References section:

    Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Li S, Wang L, Berman M, Kong YY, Dorf ME. Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8. 10.1016/j.immuni.2011.06.014 PubMed 21903422