Skip to main content
Addgene

pCMV3TAG8li-hSTT3A-3FLAG
(Plasmid #159140)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159140 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV-3Tag-8
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5200
  • Modifications to backbone
    MCS replaced with new restriction sites: XhoI, HindIII, BamHI, NotI, ClaI
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    STT3 oligosaccharyltransferase complex catalytic subunit A
  • Alt name
    STT3A; TMC; ITM1; STT3-A
  • Species
    H. sapiens (human)
  • Entrez Gene
    STT3A (a.k.a. ITM1, STT3-A, TMC)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3x FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCT
  • 3′ sequencing primer TAATACGACTCACTATAGGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV3TAG8li-hSTT3A-3FLAG was a gift from Martin Dorf (Addgene plasmid # 159140 ; http://n2t.net/addgene:159140 ; RRID:Addgene_159140)

  • For your References section:

    Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Li S, Wang L, Berman M, Kong YY, Dorf ME. Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8. 10.1016/j.immuni.2011.06.014 PubMed 21903422
Related items:
Commonly requested with: