pEXPqcxip-hSURF4-FLAG
(Plasmid #159139)

• Purpose: Hu SURF4 -flag mammalian expression Gateway vector.
• Depositing Lab: Martin Dorf
• Publication: Li et al Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8.

Backbone

• Vector backbone: modified pQCXIP
• Backbone manufacturer: Clontech / Takara Bio
• Backbone size w/o insert (bp): 7278
• Total vector size (bp): 8091
• Modifications to backbone: Clontech's pQCXIP (7165 bp) vector was modified by insertion of a cassette into the BamHI site to create a Gateway Destination vector with a c-terminal FLAG tag. The 807bp SURF4 CDS was inserted by a Gateway reaction, leaving 25bp recombination attB sequences on either side of SURF4 sequence, followed by one FLAG epitope.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: surfeit 4
• Alt name: SURF4, ERV29
• Species: H. sapiens (human)
• Insert Size (bp): 813
• GenBank ID: NM_033161.4
• Entrez Gene: SURF4 (a.k.a. ERV29)
• Promoter: CMV (cytomegalovirus) enhancer and the MSV (mouse sarcoma virus) promoter
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: acgccatccacgctgttttgacct
• 3′ sequencing primer: gcggaattccggatcG

Resource Information

• Supplemental Documents:
  • pEXPqcxip-hSURF4-FLAG.gbk
• A portion of this plasmid was derived from a plasmid made by: 'PlasmID Repository' of the Dana Farber /Harvard Cancer Center DNA Resource Core, now closed. # HsCD00082442 FLH267066.01L .

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector is bicistronic with an IRES and puromycin resistance following the SURF4.

Using the given reverse primer, the FLAG tag cannot be Sanger sequenced since they are only 17bp apart. More distant primers give poor sequence data because of the homomeric sequence of the IRES.
This is the more distal reverse primer originally suggested by Clontech, which gives poor data: aagcggcttcggccagtaacgtta .

Alternate 5' CMV primers can be used, but they should first be checked against the vector's sequence to make sure that they do not occur more than one time.