pMSCVpuro-Cas9-EGFP
(Plasmid #159126)

• Purpose: Expresses active Cas9 fused with EGFP for fluorescence microscopy
• Depositing Lab: Taekjip Ha
• Publication: Liu et al Science. 2020 Jun 12;368(6496):1265-1269. doi: 10.1126/science.aay8204.

Backbone

• Vector backbone: pMSCVpuro
• Total vector size (bp): 11222
• Vector type: Mammalian Expression, Retroviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 fused to EGFP
• Species: H. sapiens (human)
• Insert Size (bp): 4926
• Promoter: MSCV LTR promoter
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: cccttgaacctcctcgttcgacc
• 3′ sequencing primer: cagcggggctgctaaagcgcatgc

Resource Information

• Supplemental Documents:
  • pmscvpuro-cas9-egfp.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the the M13R primer region is missing compared to the original depositor's sequence.