pAAV-hSyn-FLEX-TeLC-P2A-dTomato
(Plasmid #159102)

• Purpose: Cre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.
• Depositing Lab: Sandeep Datta
• Publication: Pashkovski et al Nature. 2020 Jul;583(7815):253-258. doi: 10.1038/s41586-020-2451-1. Epub 2020 Jul 1.

Backbone

• Vector backbone: pAAV-hSyn-FLEX-TeLC-P2A-EYFP
• Backbone size w/o insert (bp): 4891
• Total vector size (bp): 7088
• Modifications to backbone: pAAV-hSyn-FLEX-TeLC-P2A-EYFP was digested with AscI and NheI to remove eYFP. A gene fragment containing dTomato with the SV40 nuclear localization signal was cloned into the TeLC backbone via isothermal assembly.
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TeLC-P2A-NLS-dTomato
• Alt name: Tetanus toxin light chain, TeLC, TeTxLC
• Alt name: dTomato, dTom
• Species: Synthetic
• Insert Size (bp): 2187
• GenBank ID: AAV52168
• Promoter: hSynapsin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctcagcgctgcctcagtct
• 3′ sequencing primer: actgagatagagctgggcaaga

Resource Information

• Supplemental Documents:
  • paav-hsyn-flex-telc-p2a-nls-dtomato.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry