p35S::SP-mCherry-GFP-HDEL
(Plasmid #159097)

• Purpose: Positive control for FRET in plant ER / nuclear envelope.
• Depositing Lab: Joe McKenna
• Publication: McKenna et al Front Plant Sci. 2021 Feb 17;12:645218. doi: 10.3389/fpls.2021.645218. eCollection 2021.

Backbone

• Vector backbone: pB7FWG2
• Backbone manufacturer: Ghent
• Backbone size w/o insert (bp): 11628
• Total vector size (bp): 11495
• Modifications to backbone: Introduction of SP-mCherry-GFP-HDEL for FRET positive control
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SP-mCherry-GFP-HDEL
• Species: Synthetic
• Insert Size (bp): 1528
• Promoter: 35S
• Tag / Fusion Protein:
  • mCherry, GFP

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ctgttccacgatggtgtagtcc
• 3′ sequencing primer: ctgttccacgatggtgtagtcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS and diagnostic digest data shows a larger than expected plasmid sequence, relative to the sequence provided by the depositing laboratory, including a potential duplication of the insert sequence.

This construct is used as an positive control for apFRET in the ER or outer nuclear envelope in plant cells. The mCherry and GFP are fused by a GGSGG amino acid linker.