Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDest-1.7kbfabp6-eGFP-pA-CrymCherry
(Plasmid #159088)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159088 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDESTtol2pACrymCherry
  • Backbone manufacturer
    Berger et. al.
  • Vector type
    fluorescent reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    1.7kb fabp6 promoter
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1700
  • Entrez Gene
    fabp6 (a.k.a. zgc:92421)
  • Promoter 1.7kb fabp6

Cloning Information for Gene/Insert 1

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ttaaggccggccGATGATCCCAACCCTGTAATGAGTTCCTGG
  • 3′ sequencing primer aattggcgcgccTTGAGAGCTGAGGTACTGATGGGTGAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eGFP
  • Alt name
    tol2kit #383 pME-EGFP

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    polyA
  • Alt name
    tol2kit #302 p3E-polyA

Cloning Information for Gene/Insert 3

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDest-1.7kbfabp6-eGFP-pA-CrymCherry was a gift from John Rawls (Addgene plasmid # 159088 ; http://n2t.net/addgene:159088 ; RRID:Addgene_159088)
  • For your References section:

    Fxr signaling and microbial metabolism of bile salts in the zebrafish intestine. Wen J, Mercado GP, Volland A, Doden HL, Lickwar CR, Crooks T, Kakiyama G, Kelly C, Cocchiaro JL, Ridlon JM, Rawls JF. Sci Adv. 2021 Jul 23;7(30). pii: 7/30/eabg1371. doi: 10.1126/sciadv.abg1371. Print 2021 Jul. 10.1126/sciadv.abg1371 PubMed 34301599