Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKL13-MgtC bb118
(Plasmid #158982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158982 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    bb118
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 3080
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mgtC
  • Species
    Salmonella enterica serovar typhimurium
  • Insert Size (bp)
    700
  • GenBank ID
    CP053865.1
  • Promoter Bba_J23118 (sigma 70)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer gctcactcaaaggcggtaat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.04.23.058362 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL13-MgtC bb118 was a gift from Joel Kralj (Addgene plasmid # 158982 ; http://n2t.net/addgene:158982 ; RRID:Addgene_158982)
  • For your References section:

    Membrane voltage dysregulation driven by metabolic dysfunction underlies bactericidal activity of aminoglycosides. Bruni GN, Kralj JM. Elife. 2020 Aug 4;9. pii: 58706. doi: 10.7554/eLife.58706. 10.7554/eLife.58706 PubMed 32748785