pKL10-mRuby-iATPSnFR1.0 bb118
(Plasmid #158980)

• Purpose: Constitutive expression (sigma 70 promoter) of the ratiometric mRuby-iATPSnFR1.0 ATP indicator in E. coli.
• Depositing Lab: Joel Kralj
• Publication: Bruni et al eLife. 2020 Aug 4;9. pii: 58706. doi: 10.7554/eLife.58706.

Backbone

• Vector backbone: bb118
• Backbone size w/o insert (bp): 2300
• Total vector size (bp): 4220
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mruby-iATPSNfR1.0
• Species: Synthetic
• Insert Size (bp): 2100
• Mutation: codon optimized for e. coli from Addgene#102557
• Promoter: Bba_J23118 (sigma 70)
• Tag / Fusion Protein:
  • mruby3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: gctcactcaaaggcggtaat

Resource Information

• A portion of this plasmid was derived from a plasmid made by: https://www.nature.com/articles/s41467-019-08441-5

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mruby-iATPSnFR was engineered in the paper above, then codon optimized for E. coli on a G-block and cloned into our bb118 backbone to facilitate constitutive expression . Please visit https://doi.org/10.1101/2020.04.23.058362 for bioRxiv preprint.