Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-trGluc
(Plasmid #158959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158959 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CSCW-IRES-GFP
  • Backbone size w/o insert (bp) 8644
  • Total vector size (bp) 9006
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    trGluc
  • Alt name
    truncated Gluc
  • Alt name
    gibberish Gluc
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    362
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCAAAATCAACGGGACTTT
  • 3′ sequencing primer AACTCACAACGTGGCACTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone came from Partners Research Cores #LEN071
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-trGluc was a gift from Charles P. Lai (Addgene plasmid # 158959 ; http://n2t.net/addgene:158959 ; RRID:Addgene_158959)
  • For your References section:

    A multiplexed bioluminescent reporter for sensitive and non-invasive tracking of DNA double strand break repair dynamics in vitro and in vivo. Chien JC, Tabet E, Pinkham K, da Hora CC, Chang JC, Lin S, Badr CE, Lai CP. Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669. 10.1093/nar/gkaa669 PubMed 32797168