pLenti-trGluc
(Plasmid #158959)

• Purpose: DNA donor plasmid containing repair template for Gaussia luciferase (Gluc) of bioluminescent repair reporter (BLRR).
• Depositing Lab: Charles P. Lai
• Publication: Chien et al Nucleic Acids Res. 2020 Aug 14. pii: 5892751. doi: 10.1093/nar/gkaa669.

Backbone

• Vector backbone: CSCW-IRES-GFP
• Backbone size w/o insert (bp): 8644
• Total vector size (bp): 9006
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: trGluc
• Alt name: truncated Gluc
• Alt name: gibberish Gluc
• Species: H. sapiens (human)
• Insert Size (bp): 362
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACCAAAATCAACGGGACTTT
• 3′ sequencing primer: AACTCACAACGTGGCACTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone came from Partners Research Cores #LEN071
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry