AAV-hACE2-cMYC-Flag
(Plasmid #158957)

• Purpose: Used for expression of human ACE2 with AAV packaging
• Depositing Lab: Akiko Iwasaki
• Publication: Mouse model of SARS-CoV-2 (unpublished)

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 5283
• Total vector size (bp): 7834
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Human ACE2
• Alt name: hACE2
• Species: H. sapiens (human)
• Insert Size (bp): 2444
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • Flag (C terminal on insert)
  • MYC (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Origene
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

I have written confirmation from Origene that I can share this plasmid with Addgene for distribution