Skip to main content
Addgene

PET.SUMO eIF4G1 +MIC 1-200
(Plasmid #158792)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158792 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET SUMO
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eIF4G1 (with microexon) codon optimized
  • Species
    H. sapiens (human)
  • Mutation
    amino acids 1-200
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHIS (N terminal on backbone)
    • SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGATTCTTGTACGACGGTATTAG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PET.SUMO eIF4G1 +MIC 1-200 was a gift from Benjamin Blencowe (Addgene plasmid # 158792 ; http://n2t.net/addgene:158792 ; RRID:Addgene_158792)

  • For your References section:

    Autism-Misregulated eIF4G Microexons Control Synaptic Translation and Higher Order Cognitive Functions. Gonatopoulos-Pournatzis T, Niibori R, Salter EW, Weatheritt RJ, Tsang B, Farhangmehr S, Liang X, Braunschweig U, Roth J, Zhang S, Henderson T, Sharma E, Quesnel-Vallieres M, Permanyer J, Maier S, Georgiou J, Irimia M, Sonenberg N, Forman-Kay JD, Gingras AC, Collingridge GL, Woodin MA, Cordes SP, Blencowe BJ. Mol Cell. 2020 Mar 19;77(6):1176-1192.e16. doi: 10.1016/j.molcel.2020.01.006. Epub 2020 Jan 29. 10.1016/j.molcel.2020.01.006 PubMed 31999954
Related items:
Commonly requested with: