HDM_SARS2_Spike_del21_D614G
(Plasmid #158762)

• Purpose: Mammalian expression vector for expressing SARS-2 Spike with 21 aa del at C-terminus and pt mutation D to G at site 614
• Depositing Lab: Jesse Bloom
• Publication: Crawford et al Viruses. 2020 May 6;12(5). pii: v12050513. doi: 10.3390/v12050513.

Backbone

• Vector backbone: HDM
• Backbone size w/o insert (bp): 4552
• Total vector size (bp): 8314
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS2-Spike_del21_D614G
• Alt name: Spike
• Species: Synthetic; Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 3672
• Mutation: deleted amino acids 1257-1278, changed aspartic acid at position 614 to glycine
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: ggcccttttgctaatcatgttcatacctcttatct
• 3′ sequencing primer: ttaaatgcactgacctcccacattc

Resource Information

• Supplemental Documents:
  • 2800_HDM_Spikedelta21_D614G.gb
• Articles Citing this Plasmid:
  • 14 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry