6xHis-TagRFP-T_A1aY1
(Plasmid #158754)

• Purpose: Expression of 6x His tagged TagRFP-T_A1aY1 in mammalian cells for detection of tyrosinated microtubules.
• Depositing Lab: Minhajuddin Sirajuddin
• Publication: Kesarwani et al J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107.

Backbone

• Vector backbone: pIRESneo2
• Backbone manufacturer: Addgene plasmid # 12298 cloned with 6x-His-TagRFP-T_A1aY1 gene (Rusan et al Mol Biol Cell. 2001 Apr . 12(4):971-80. )
• Backbone size w/o insert (bp): 6074
• Total vector size (bp): 6263
• Modifications to backbone: Received Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI site.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 6xHistidine_TagRFP-T_A1aY1
• Alt name: 6x His-Red tyrosination sensor
• Alt name: 6x His-A1aY1 sensor
• Insert Size (bp): 189
• Promoter: CMV Promoter
• Tags / Fusion Proteins:
  • 6x-Histidine tag (N terminal on insert)
  • TagRFP-T (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV_Forward Primer
• 3′ sequencing primer: GAGAGGGAGTACTCACCCCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Obtained Addgene plasmid # 12298 and cloned with 6x-His-TagRFP-T_A1aY1 gene in between NheI and BamHI restriction sites.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry