pPICZ-His6-K2P4.1B-mCherry-StreptagII
(Plasmid
#158744)
-
PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPICZ
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 4910
-
Vector typeYeast Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameK2P4.1-B
-
Alt nameTRAAK
-
Alt nameKCNK4
-
SpeciesH. sapiens (human)
-
MutationResidues 1-290 and N-linked glycosylation sites removed (N104Q/N108Q)
-
Entrez GeneKCNK4 (a.k.a. FHEIG, K2p4.1, TRAAK, TRAAK1)
- Promoter AOX1
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- mCherry with Streptag II (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert was synthesized by IDT
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPICZ-His6-K2P4.1B-mCherry-StreptagII was a gift from Arthur Laganowsky (Addgene plasmid # 158744 ; http://n2t.net/addgene:158744 ; RRID:Addgene_158744) -
For your References section:
Selective regulation of human TRAAK channels by biologically active phospholipids. Schrecke S, Zhu Y, McCabe JW, Bartz M, Packianathan C, Zhao M, Zhou M, Russell D, Laganowsky A. Nat Chem Biol. 2021 Jan;17(1):89-95. doi: 10.1038/s41589-020-00659-5. Epub 2020 Sep 28. 10.1038/s41589-020-00659-5 PubMed 32989299