pPICZ-His6-K2P4.1A-mCherry-StreptagII
(Plasmid #158743)

• Purpose: Expresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.
• Depositing Lab: Arthur Laganowsky
• Publication: Schrecke et al Nat Chem Biol. 2021 Jan;17(1):89-95. doi: 10.1038/s41589-020-00659-5. Epub 2020 Sep 28.

Backbone

• Vector backbone: pPICZ
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 4832
• Vector type: Yeast Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: K2P4.1-A
• Alt name: TRAAK
• Alt name: KCNK4
• Species: H. sapiens (human)
• Mutation: Residues 1-264 with N-linked glycosylation sites mutated from Asn to Qln
• Entrez Gene: KCNK4 (a.k.a. FHEIG, K2p4.1, TRAAK, TRAAK1)
• Promoter: AOX1
• Tags / Fusion Proteins:
  • His6 (N terminal on insert)
  • mCherry with Streptag II (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTGGTTCCAATTGACAAGC
• 3′ sequencing primer: GCAAATGGCATTCTGACATCC

Resource Information

• Supplemental Documents:
  • NHis-TEV-K2P4.1A-TEV-mCherry-Strep.gb
• A portion of this plasmid was derived from a plasmid made by: Insert was synthesized by IDT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry