pCR-Hyg
(Plasmid #158708)

• Purpose: For cloning and constitutive expression of crRNAs in mycobacterium
• Depositing Lab: Yi-Cheng Sun
• Publication: Yan et al Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00947-17. doi: 10.1128/AEM.00947-17. Print 2017 Sep 1.

Backbone

• Vector backbone: pSL001
• Backbone manufacturer: from Houhui Song's Lab
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology ; Mycobacteria Expression

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: crRNA
• gRNA/shRNA sequence: gtctaagaactttaaataatttctactgttgtagattccgtctccggcctccagtagtattcggcgaagcttgtctaagaactttaaataatttctactgttgtagat
• Species: Other
• Promoter: Hsp60

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: unknown

Resource Information

• Supplemental Documents:
  • pCR-Hyg.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that several differences were identified in the plasmid backbone compared to the depositor's sequence. These differences do not affect plasmid function.