pJV53-Cas12a
(Plasmid
#158706)
-
PurposeCRISPR system used for genome editing in Mycobacterium smegmatis, expresses codon-optimized FnCpf1 and the recombination proteins gp60 and gp61
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJV53
-
Backbone manufactureraddgene 26904
- Backbone size w/o insert (bp) 8919
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFnCpf1
-
SpeciesFrancisella tularensis subsp. Novicida
-
Insert Size (bp)3903
- Promoter TetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ACTAGTGGCCATGATGGCAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJV53-Cas12a was a gift from Yi-Cheng Sun (Addgene plasmid # 158706 ; http://n2t.net/addgene:158706 ; RRID:Addgene_158706) -
For your References section:
CRISPR-Cas12a-Assisted Recombineering in Bacteria. Yan MY, Yan HQ, Ren GX, Zhao JP, Guo XP, Sun YC. Appl Environ Microbiol. 2017 Aug 17;83(17). pii: AEM.00947-17. doi: 10.1128/AEM.00947-17. Print 2017 Sep 1. 10.1128/AEM.00947-17 PubMed 28646112