Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR_502_sgCD45
(Plasmid #158705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158705 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXPR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD45
  • Alt name
    PTPRC
  • gRNA/shRNA sequence
    GTTGTTCTAAGTCAGTAGAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTPRC (a.k.a. B220, CD45, CD45R, GP180, IMD105, L-CA, LCA, LY5, T200)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For questions regarding use of this plasmid, please contact John Doench.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_502_sgCD45 was a gift from John Doench & David Root (Addgene plasmid # 158705 ; http://n2t.net/addgene:158705 ; RRID:Addgene_158705)
  • For your References section:

    Identification of Antinorovirus Genes in Human Cells Using Genome-Wide CRISPR Activation Screening. Orchard RC, Sullender ME, Dunlap BF, Balce DR, Doench JG, Virgin HW. J Virol. 2018 Dec 10;93(1). pii: JVI.01324-18. doi: 10.1128/JVI.01324-18. Print 2019 Jan 1. 10.1128/JVI.01324-18 PubMed 30305350