pet11a-ABLE
(Plasmid #158627)

• Purpose: Amp resistant IPTG inducible 6xHis-TEV-ABLE protein for E. coli expression
• Depositing Lab: William DeGrado
• Publication: Polizzi et al Science. 2020 Sep 4;369(6508):1227-1233. doi: 10.1126/science.abb8330.

Backbone

• Vector backbone: pet11a
• Backbone manufacturer: genscript
• Backbone size w/o insert (bp): 5641
• Total vector size (bp): 6061
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Apixaban-Binding Helical Bundle
• Alt name: ABLE
• Species: Synthetic
• Insert Size (bp): 420
• Promoter: T7
• Tag / Fusion Protein:
  • 6x His-tag and TEV cleavage tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pet11a-ABLE.gb
• A portion of this plasmid was derived from a plasmid made by: GenScript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry