Skip to main content
Addgene

pSWD95
(Plasmid #158617)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158617 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXCFPC-6
  • Backbone size w/o insert (bp) 4828
  • Total vector size (bp) 8389
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CckA 1-182, Linker SNVTRHRSATE, mClover3, CckA 183-691, Linker SNVTRHRSAT, mRuby3
  • Alt name
    CckA FRET Sensor
  • Species
    Caulobacter crescentus
  • Insert Size (bp)
    3558
  • GenBank ID
    AF133718.1
  • Promoter Xylose

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCACATGTTAGCGCTACCAAGTGC
  • 3′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector from Martin Thanbichler PM ID 17959646 "A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus".

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSWD95 was a gift from Seth Childers (Addgene plasmid # 158617 ; http://n2t.net/addgene:158617 ; RRID:Addgene_158617)
  • For your References section:

    Design of a Histidine Kinase FRET Sensor to Detect Complex Signal Integration within Living Bacteria. Duvall SW, Childers WS. ACS Sens. 2020 Jun 26;5(6):1589-1596. doi: 10.1021/acssensors.0c00008. Epub 2020 Jun 16. 10.1021/acssensors.0c00008 PubMed 32495620