Skip to main content
Addgene

pLKO-Cre sgAmotl2 v3
(Plasmid #158602)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158602 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pLKO-Cre stuffer v3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Amotl2 sgRNA
  • gRNA/shRNA sequence
    Amotl2
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Cre sgAmotl2 v3 was a gift from Daniel Schramek (Addgene plasmid # 158602 ; http://n2t.net/addgene:158602 ; RRID:Addgene_158602)

  • For your References section:

    Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling. Loganathan SK, Schleicher K, Malik A, Quevedo R, Langille E, Teng K, Oh RH, Rathod B, Tsai R, Samavarchi-Tehrani P, Pugh TJ, Gingras AC, Schramek D. Science. 2020 Mar 13;367(6483):1264-1269. doi: 10.1126/science.aax0902. 10.1126/science.aax0902 PubMed 32165588
Related items:
Commonly requested with: