p416-TEF-membrane localization signal-tagBFP-wrmScarlet11-TEF terminator
(Plasmid #158585)

• Purpose: Expresses membrane localized tagBFP with wrmScarlet11 C-terminal fusion in S. cerevisiae
• Depositing Lab: Cynthia Kenyon
• Publication: Goudeau et al Genetics. 2021 Apr 15;217(4). pii: 6126424. doi: 10.1093/genetics/iyab014.

Backbone

• Vector backbone: p416
• Backbone size w/o insert (bp): 5350
• Total vector size (bp): 6226
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: membrane localization signal-tagBFP-wrmScarlet11
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 876
• Mutation: GGGS linker
• Promoter: TEF
• Tag / Fusion Protein:
  • tagBFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccactgaggttcttctttcatatac
• 3′ sequencing primer: gaacaactacaatataaaaaaactatacaaatg

Resource Information

• Supplemental Documents:
  • p416-TEF-membrane localization signal-tagBFP-wrmScarletS11-TEF terminator.gb
• A portion of this plasmid was derived from a plasmid made by: gene synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry