Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR1A_no_ccDB_mUty
(Plasmid #158570)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158570 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene #17398
  • Backbone size w/o insert (bp) 2294
  • Total vector size (bp) 6116
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mus musculus ubiquitously transcribed tetratricopeptide repeat containing, Y-linked (Uty), transcript variant 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3822
  • GenBank ID
    NM_001326682.1
  • Entrez Gene
    Uty (a.k.a. Hydb, mKIAA4057)
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ApaI (destroyed during cloning)
  • 5′ sequencing primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG
  • 3′ sequencing primer pENTR-R ATGGCTCATAACACCCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A_no_ccDB_mUty was a gift from Christian Deschepper (Addgene plasmid # 158570 ; http://n2t.net/addgene:158570 ; RRID:Addgene_158570)
  • For your References section:

    Regulatory effects of the Uty/Ddx3y locus on neighboring chromosome Y genes and autosomal mRNA transcripts in adult mouse non-reproductive cells. Deschepper CF. Sci Rep. 2020 Sep 10;10(1):14900. doi: 10.1038/s41598-020-71447-3. 10.1038/s41598-020-71447-3 PubMed 32913328