Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-CuO-V5 CASC3 siRes 110-480 WT
(Plasmid #158543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB-Cuo-MCS-IRES-GFP-EF1α-CymR-Puro
  • Backbone manufacturer
    SBI
  • Backbone size w/o insert (bp) 9509
  • Total vector size (bp) 10659
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CASC3; BTZ; MLN51
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1113
  • Mutation
    Amino acids 110-480, C-terminal deletion
  • Entrez Gene
    CASC3 (a.k.a. BTZ, MLN51)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe (not destroyed)
  • 3′ cloning site Not (not destroyed)
  • 5′ sequencing primer CCGATCTGGCCATACACTTG
  • 3′ sequencing primer GCCCTCACATTGCCAAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CuO-V5 CASC3 siRes 110-480 WT was a gift from Niels Gehring (Addgene plasmid # 158543 ; http://n2t.net/addgene:158543 ; RRID:Addgene_158543)
  • For your References section:

    CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complex. Gerbracht JV, Boehm V, Britto-Borges T, Kallabis S, Wiederstein JL, Ciriello S, Aschemeier DU, Kruger M, Frese CK, Altmuller J, Dieterich C, Gehring NH. Nucleic Acids Res. 2020 Jul 4. pii: 5867419. doi: 10.1093/nar/gkaa564. 10.1093/nar/gkaa564 PubMed 32621609