pSI-356 v2
(Plasmid
#158431)
-
Purpose(Empty Backbone) SpCas9 sgRNA cloning backbone
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 2627
-
Vector typeMammalian Expression, CRISPR
- Promoter Human H6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tttcccatgattccttcatattt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bylentiGuide-Puro (https://www.addgene.org/52963/)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For the cloning of gRNA, two BsmbI sites flanked by 2kb filler sequences can be used for Golden Gate Assembly.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSI-356 v2 was a gift from Nozomu Yachie (Addgene plasmid # 158431 ; http://n2t.net/addgene:158431 ; RRID:Addgene_158431) -
For your References section:
Highly Multiplexed Analysis of CRISPR Genome Editing Outcomes in Mammalian Cells. Ishiguro S, Yachie N. Methods Mol Biol. 2021;2312:193-223. doi: 10.1007/978-1-0716-1441-9_12. 10.1007/978-1-0716-1441-9_12 PubMed 34228292
Map uploaded by the depositor.
