pLenti-hSyn-Gαi*-BERKY1
(Plasmid #158427)

• Purpose: BRET biosensor for detection of Gαi-GTP in lentiviral vector pLenti-hSyn
• Depositing Lab: Mikel Garcia-Marcos
• Publication: Maziarz et al Cell. 2020 Jun 27. pii: S0092-8674(20)30752-2. doi: 10.1016/j.cell.2020.06.020.

Backbone

• Vector backbone: pLenti-hSynapsin-Cre-WPRE (Addgene Plasmid #86641)
• Total vector size (bp): 10188
• Modifications to backbone: AgeI-Cre-EcoRI removed during cloning
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lyn11-Nluc-ER/K linker-YFP-KB1753-myc
• Alt name: Gai*-BERKY1
• Insert Size (bp): 1728
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI, replaced with NheI/GCCACC (destroyed during cloning)
• 3′ cloning site: EcoRI, replaced with XbaI/AgeI (destroyed during cloning)
• 5′ sequencing primer: gcagcggaggagtcgtgtcg
• 3′ sequencing primer: ccacatagcgtaaaaggagc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry