-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15827 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV-puro-gateway
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6391
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB broth
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRibosomal S6 kinase 2
-
Alt nameRSK2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2253
-
Mutationwild type
-
GenBank IDAY083469
-
Entrez GeneRps6ka3 (a.k.a. MAPKAPK-1b, MPK-9, Rs, Rsk2, S6K-alpha3, p90RSK3, pp90RSK2)
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site Gateway1 (not destroyed)
- 3′ cloning site Gateway2 (not destroyed)
- 5′ sequencing primer CCCTGGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTemplate pKH3-RSK2 was obtained from Morten Frodin in Department of Clinical Biochemistry, Glostrup Hospital, Denmark.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-puro-mycRSK2wt was a gift from Jing Chen (Addgene plasmid # 15827 ; http://n2t.net/addgene:15827 ; RRID:Addgene_15827) -
For your References section:
FGFR3 Activates RSK2 to Mediate Hematopoietic Transformation through Tyrosine Phosphorylation of RSK2 and Activation of the MEK/ERK Pathway. Kang S, Dong S, Gu TL, Guo A, Cohen MS, Lonial S, Khoury HJ, Fabbro D, Gilliland DG, Bergsagel PL, Taunton J, Polakiewicz RD, Chen J. Cancer Cell. 2007 Sep . 12(3):201-14. 10.1016/j.ccr.2007.08.003 PubMed 17785202