Skip to main content
Addgene

pLKO_HSV.Ollas.V5_NGFR
(Plasmid #158269)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158269 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pro-Code Tagged human dNGFR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1000
  • Mutation
    Truncation of the signaling domain
  • Entrez Gene
    NGFR (a.k.a. CD271, Gp80-LNGFR, TNFRSF16, p75(NTR), p75NTR)
  • Promoter EF1a
  • Tag / Fusion Protein
    • HSV.Ollas.V5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer cctttttgagtttggatcttggttcat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO_HSV.Ollas.V5_NGFR was a gift from Brian Brown (Addgene plasmid # 158269 ; http://n2t.net/addgene:158269 ; RRID:Addgene_158269)
  • For your References section:

    Protein Barcodes Enable High-Dimensional Single-Cell CRISPR Screens. Wroblewska A, Dhainaut M, Ben-Zvi B, Rose SA, Park ES, Amir ED, Bektesevic A, Baccarini A, Merad M, Rahman AH, Brown BD. Cell. 2018 Nov 1;175(4):1141-1155.e16. doi: 10.1016/j.cell.2018.09.022. Epub 2018 Oct 18. 10.1016/j.cell.2018.09.022 PubMed 30343902