Skip to main content
Addgene

pLenti-GRET
(Plasmid #158222)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158222 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti CMV Puro DEST (w118-1)
  • Backbone size w/o insert (bp) 7973
  • Total vector size (bp) 9232
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    32-degree Celsius for 16-18 hours
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-Nluc
  • Species
    Synthetic
  • Insert Size (bp)
    1249
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGGTGGGAGGTCTATATAAGCAG
  • 3′ sequencing primer CATACGGGAAGCAATAGCATGA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid # 70185

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-GRET was a gift from Charles P. Lai (Addgene plasmid # 158222 ; http://n2t.net/addgene:158222 ; RRID:Addgene_158222)

  • For your References section:

    Multiresolution Imaging Using Bioluminescence Resonance Energy Transfer Identifies Distinct Biodistribution Profiles of Extracellular Vesicles and Exomeres with Redirected Tropism. Wu AY, Sung YC, Chen YJ, Chou ST, Guo V, Chien JC, Ko JJ, Yang AL, Huang HC, Chuang JC, Wu S, Ho MR, Ericsson M, Lin WW, Cheung CHY, Juan HF, Ueda K, Chen Y, Lai CP. Adv Sci (Weinh). 2020 Aug 16;7(19):2001467. doi: 10.1002/advs.202001467. eCollection 2020 Oct. 10.1002/advs.202001467 PubMed 33042758
Related items:
Commonly requested with: