pLenti-PalmGRET
(Plasmid #158221)

• Purpose: BRET-based reporter to enable pan-extracellular particle labelling ranging from exomeres (< 50 nm) to small (< 200 nm; e.g. exosomes) and medium and large (> 200 nm; e.g. microvesicles) EVs.
• Depositing Lab: Charles P. Lai
• Publication: Wu et al Adv Sci (Weinh). 2020 Aug 16;7(19):2001467. doi: 10.1002/advs.202001467. eCollection 2020 Oct.

Backbone

• Vector backbone: pLenti CMV Puro DEST (w118-1)
• Backbone size w/o insert (bp): 7973
• Total vector size (bp): 9292
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: 32-degree Celsius for 16-18 hours
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PalmGFP-Nluc
• Species: Synthetic
• Insert Size (bp): 1309
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGGTGGGAGGTCTATATAAGCAG
• 3′ sequencing primer: CATACGGGAAGCAATAGCATGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid # 70185
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry