Ef1a-QCP-3xBFP
(Plasmid #158206)

• Purpose: Qb coat protein fused to three repeats of the blue fluorescent protein under a Efla promoter.
• Depositing Lab: Roee Amit
• Publication: Katz et al Nat Commun. 2021 Mar 11;12(1):1576. doi: 10.1038/s41467-021-21578-6.

Backbone

• Vector backbone: Addgene number 75384
• Modifications to backbone: Instead of the MS2 coat protein we inserted a QB coat protein sequence.
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QCP under the Elfa promoter and three BFP tags
• Species: Synthetic
• Promoter: Elfa
• Tag / Fusion Protein:
  • 3xBFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCCGTGAACGTTCTTTTTCGCAACG

Resource Information

• Supplemental Documents:
  • Ef1a-QCP-3xBFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS result found different linkers between the BFP's when compared to the backbone #75384. The depositor confirmed they observed strong BFP fluorescence and the different linkers are not a concern.