p663-UBC-miniTurbo-V5-CAMK1G_IDG-K
(Plasmid #158168)

• Purpose: Gateway destination clone of CAMK1G (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomics
• Depositing Lab: Ben Major
• Publication: Major lab plasmids for proteomics-based protein-interaction and protein-proximity network generation (unpublished)

Backbone

• Vector backbone: pDest663
• Backbone manufacturer: PEL
• Backbone size w/o insert (bp): 9019
• Vector type: Mammalian Expression, Lentiviral ; Gateway Destination
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: miniTurbo-V5-CAMK1G
• Alt name: CAMK1G
• Species: H. sapiens (human)
• Entrez Gene: CAMK1G (a.k.a. RP1-272L16.2, CLICKIII, VWS1, dJ272L16.1)
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • miniTurbo-V5 (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GCCCGAAGGAATAGAAGAAGAA
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • 158168. p663-UBC-miniTurbo-V5-CAMK1G_IDG-K.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. These lentiviral gateway destination plasmids were generated, as part of the Kinase-Data and Resource Generating Center (DRGC), using the single fragment or multisite gateway cloning technology. They were used for generating proteomics-based protein-interaction and protein-proximity networks that can be accessed through the kinase-DRGC website https://darkkinome.org/. Each plasmid has either an N- or C-terminal fusion protein (Flag/ V5/V5-miniTurbo/V5-TurboID/miniTurbo-V5/TurboID-V5) tagged understudied kinase driven under either a CMV or Ubiquitin (UBC) promoter. All inserts in the pENTR plasmids used to generate the deposited destination plasmids were end-sequenced and insert size validated prior to multi-site gateway cloning. The combined insert size of the single fragment or three fragment destination plasmids were confirmed by restriction digestion (BsrGI, and EcoRV for pDest667; BsrGI, EcoRV, and BstZ17I for pDest663; and BsrGI for pHAGE) and all plasmids were partially sequenced to ensure in-frame ORFs and fusion tags.