pET-A3A(N57Q)-BE3
(Plasmid
#158157)
-
PurposeT7 promoter bacterial expression plasmid for hAPOBEC3A(N57Q)-BE3 with N-terminal 6xHis-tag and C-terminal SV40 NLS
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name6xHis-hA3A(N57Q)-XTEN linker-hSpCas9n(D10A)-UGI-SV40NLS
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag on N-terminus
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-A3A(N57Q)-BE3 was a gift from Keith Joung (Addgene plasmid # 158157 ; http://n2t.net/addgene:158157 ; RRID:Addgene_158157) -
For your References section:
Therapeutic base editing of human hematopoietic stem cells. Zeng J, Wu Y, Ren C, Bonanno J, Shen AH, Shea D, Gehrke JM, Clement K, Luk K, Yao Q, Kim R, Wolfe SA, Manis JP, Pinello L, Joung JK, Bauer DE. Nat Med. 2020 Apr;26(4):535-541. doi: 10.1038/s41591-020-0790-y. Epub 2020 Mar 16. 10.1038/s41591-020-0790-y PubMed 32284612
Map uploaded by the depositor.
