pRS416-Aga1p-FAPB2.3.6L1TAG
(Plasmid
#158148)
-
PurposeYeast display reporter for non-display yeast strains (TAG construct)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS416
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4898
- Total vector size (bp) 9048
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAga1p-FAPB2.3.6
-
Insert Size (bp)4100
-
MutationCloned in a TAG codon at the first position of the light chain of the scFv
- Promoter GAL1-10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACAAGGAGGAGGATGAAAGGACC
- 3′ sequencing primer GGATGTGCTGCAAGGCGATTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS416-Aga1p-FAPB2.3.6L1TAG was a gift from James Van Deventer (Addgene plasmid # 158148 ; http://n2t.net/addgene:158148 ; RRID:Addgene_158148) -
For your References section:
Reporter system architecture affects measurements of noncanonical amino acid incorporation efficiency and fidelity. Potts KA, Stieglitz JT, Lei M, Van Deventer JA. Mol Syst Des Eng. 2020 Feb 1;5(2):573-588. doi: 10.1039/c9me00107g. Epub 2020 Jan 23. 10.1039/c9me00107g PubMed 33791108