Skip to main content
Addgene

pCTCON2-Aga1p
(Plasmid #158141)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158141 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCTCON2
  • Backbone size w/o insert (bp) 6314
  • Total vector size (bp) 8499
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Aga1p
  • Insert Size (bp)
    2178
  • Promoter GAL10

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTCCGGCTCCTATGTTGTGTGGAA
  • 3′ sequencing primer CCTCTTCATAACCATAAAAGCTAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Aga1p gene was amplified from YIP sHRPa-Aga1p. This was a gift to our lab from Alice Ting (Addgene plasmid #73151)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Aga1p ORF contains an I682T difference compared to the ancestral gene. The depositing lab does not believe this to be of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCTCON2-Aga1p was a gift from James Van Deventer (Addgene plasmid # 158141 ; http://n2t.net/addgene:158141 ; RRID:Addgene_158141)

  • For your References section:

    Reporter system architecture affects measurements of noncanonical amino acid incorporation efficiency and fidelity. Potts KA, Stieglitz JT, Lei M, Van Deventer JA. Mol Syst Des Eng. 2020 Feb 1;5(2):573-588. doi: 10.1039/c9me00107g. Epub 2020 Jan 23. 10.1039/c9me00107g PubMed 33791108
Related items:
Commonly requested with: