pCTCON2-BXG
(Plasmid #158127)

• Purpose: Dual fluorescent protein reporter (BFP-GFP) for ncAA incorporation (TAG construct)
• Depositing Lab: James Van Deventer
• Publication: Potts et al Mol Syst Des Eng. 2020 Feb 1;5(2):573-588. doi: 10.1039/c9me00107g. Epub 2020 Jan 23.

Backbone

• Vector backbone: pCTCON2-RXG
• Backbone size w/o insert (bp): 6494
• Total vector size (bp): 7193
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mTagBFP
• Insert Size (bp): 699
• Promoter: GAL1-10

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CTGCATAACCACTTTAACTAATACTTTC
• 3′ sequencing primer: GTAAAGTTGGTAACGGAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: BFP gene amplified from pBAD-mTagBFP2, obtained from the laboratory of Nikhil U. Nair at Tufts University and originally purchased from Addgene (Addgene plasmid #34632; http://n2t.net/addgene:34632; RRID:Addgene_34632)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry