Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-TET3G-T2A-Puro
(Plasmid #158067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158067 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX459
  • Backbone size w/o insert (bp) 4906
  • Total vector size (bp) 5650
  • Modifications to backbone
    Deletion of Cas9 gene and replacing by TET3G gene Swap of Promoter - chicken β-actin promoter
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCAG-TET3G-T2A-Puro
  • Alt name
    Tet transactivator
  • Species
    Synthetic
  • Insert Size (bp)
    1413
  • Promoter pCAG
  • Tag / Fusion Protein
    • puromycin reistance gene (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggctgtaattagctgagcaagagg
  • 3′ sequencing primer cgtgggcttgtactcggtc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-TET3G-T2A-Puro was a gift from Adolfo Rivero-Muller (Addgene plasmid # 158067 ; http://n2t.net/addgene:158067 ; RRID:Addgene_158067)
  • For your References section:

    An Improved Vector System for Homogeneous and Stable Gene Regulation. Michalec-Wawiorka B, Czapinski J, Filipek K, Rulak P, Czerwonka A, Tchorzewski M, Rivero-Muller A. Int J Mol Sci. 2021 May 14;22(10). pii: ijms22105206. doi: 10.3390/ijms22105206. 10.3390/ijms22105206 PubMed 34069024