pCAG-TET3G-T2A-Puro
(Plasmid #158067)

• Purpose: Encodes the Tet3G transactivator and puromycin resistance.
• Depositing Lab: Adolfo Rivero-Muller
• Publication: Michalec-Wawiorka et al Int J Mol Sci. 2021 May 14;22(10). pii: ijms22105206. doi: 10.3390/ijms22105206.

Backbone

• Vector backbone: PX459
• Backbone size w/o insert (bp): 4906
• Total vector size (bp): 5650
• Modifications to backbone: Deletion of Cas9 gene and replacing by TET3G gene Swap of Promoter - chicken β-actin promoter
• Vector type: Mammalian Expression, AAV
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pCAG-TET3G-T2A-Puro
• Alt name: Tet transactivator
• Species: Synthetic
• Insert Size (bp): 1413
• Promoter: pCAG
• Tag / Fusion Protein:
  • puromycin reistance gene (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggctgtaattagctgagcaagagg
• 3′ sequencing primer: cgtgggcttgtactcggtc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry